• הודעות
  • אשכולות
  • רשומים
  • לייקים
  • מחוברים כרגע
עמוד 176 מתוך 571 ראשוןראשון 126166172173174175176177178179180186226 אחרוןאחרון

מדע וידע כללי

בפורום זה תוכלו למצוא תשובות לשאלות שתמיד עניינו אתכם, ולפרסם ידיעות מתחום המדעים.
הפורום נועד לשאילת שאלות שקשורות לבית הספר, ש''ב, התכוננות למבחנים וכד' בתחום המדע.
כאן תוכלו, בין היתר, לשאול שאלות בפיזיקה, ביולוגיה, כימיה ובמגמות המדעיות בבתי הספר.
אשכול / מפרסם האשכול סטטיסטיקה הודעה אחרונה
  1. שאלה| למישהו יש תשובות של מיצב במדעים

    זה כמה מיצבים יש לנו חוברת מיצבים שאנחנו צריכים לעשות בבית ספר תשס"ו נוסח א' תשס"ז נוסח א' תשס"ח נוסח א' תשס"ט נוסח א'

    • תגובות: 8
    • צפיות: 667
    20-02-2014 09:39 עבור להודעה האחרונה
  2. שאלה| זה נכון שתא זרע זה התא היחיד .......

    זה נכון שתא זרע זה התא היחיד שיש בו רק חצי מהמטען הגנטי ? זאת אומרת רק 23 נוקלאוטוידים ?

    • תגובות: 6
    • צפיות: 121
    20-02-2014 08:59 עבור להודעה האחרונה
  3. שאלה| לאשה יש גם חומק שהיא מפרישה באורגזמה כמו הגברים?

    שהגברים באורגזמה הם מפרישים זרע האשה גם מפרישה איזה חומר ?

    • תגובות: 13
    • צפיות: 162
    19-02-2014 23:29 עבור להודעה האחרונה
  4. דיון| חושבים שיש קשר בין מקרה שקרה לאדם לאינטליגנציה שלו?

    אני מכיר אלפי סיפורים על ילדים שנודו מהחברה, שעברו טראומה, שאיבדו מישהו ועו' ומאז "נהיו חכמים יותר" שכן אם אותו מקרה לא היה קורה, כל "הכחמה"...

    • תגובות: 3
    • צפיות: 185
    19-02-2014 21:00 עבור להודעה האחרונה
  5. שאלה| סיפריה גנטית

    יש איזה אתר שבוא אני יכול למצא קוד גנטי של גנים מסוימים אני מדבר על רצף של נוקלאוטידים כמו ATGCCATGTATACGGATCTAA כחול - פרומוטר אדום -...

    • תגובות: 3
    • צפיות: 111
    19-02-2014 18:18 עבור להודעה האחרונה
  6. דיון| אולימפיאדת הפיזיקה שלב א

    מי ניגש? למדתם לזה? וכמה מינימום תשובות נכונות אתם חושבים שצריך בשביל לעלות לשלב ב?

    • תגובות: 4
    • צפיות: 436
    18-02-2014 19:57 עבור להודעה האחרונה
  7. שאלה| החוק השני של ניוטון

    קצת שאלה טיפשית אבל איך ניוטון יכל לדעת שהמשוואה שלו נכונה F=ma ? הרי שכדי למדוד את הכוח הוא השתמש במשוואה לא?

    3 עמודים
    1 2 3
    • תגובות: 34
    • צפיות: 480
    17-02-2014 19:15 עבור להודעה האחרונה
  8. דיון| האם יש ליקום גבול כולשהו?

    באופן כללי גם אם אין כלום אחרי היקום חייב להיות לו איזשהו סוג של גבול יעני קצה כולשהו של היקום

    2 עמודים
    1 2
    • תגובות: 20
    • צפיות: 417
    17-02-2014 11:47 עבור להודעה האחרונה
  9. שאלה| ידוע היכן האסטרואיד פגע?

    אני מדבר על האסטרואיד שהכחיד את הדינוזאורים, ידוע איפה הוא פגע? ואם כן, המכתש שלו עדיין קיים?

    • תגובות: 3
    • צפיות: 245
    17-02-2014 00:36 עבור להודעה האחרונה
  10. שאלה| החוק השלישי של ניוטון

    ע''פ החוק השלישי של ניוטון,אם משאית מתנגשת ברוכב אופניים,רוכב האופניים לא אמור להפעיל על המשאית כוח השווה לכוח שהיא מפעילה עליו?אז למה רוכב האופניים...

    • תגובות: 4
    • צפיות: 216
    16-02-2014 15:42 עבור להודעה האחרונה
  11. כתבה| נמצאו העקבות העתיקות ביותר של "אדם קדמון" מחוץ לאפריקה.

    העקבות נמצאו בNORFOLK שבאנגליה, בנות מעל ל800 אלף שנה והושארו שם על ידי קבוצה של מבוגרים וילדים. בשל הגיוון בגדלים של העקבות, ככל הנראה מדובר במשפחה...

    • תגובות: 12
    • צפיות: 179
    16-02-2014 15:14 עבור להודעה האחרונה
  12. שאלה| מדוע השמיים כחולים?

    מדוע השמיים כחולים? ומדוע הקרחונים כחולים והשלג לבן? ישלי את השאלה הזאת ואני לא יודע מה לכתוב. תודה לעונים.

    • תגובות: 10
    • צפיות: 410
    15-02-2014 21:29 עבור להודעה האחרונה
  13. שאלה| מהי אנרגיית גובה..?

    אני למדתי השיעור במדעים על אנרגיית גובה ועדיין לא הבנתי מזה כל כך... אפשר הסבר? נ.ב קרינה זאת התפשטות אנרגיה נכון? כי המורה שלי אומרת שקרינה זה...

    2 עמודים
    1 2
    • תגובות: 22
    • צפיות: 521
    15-02-2014 03:46 עבור להודעה האחרונה
  14. שאלה| פיסיקה-חשמל

    שלום. איך פותרים את סעיפים ב' וג' בשאלה?

    • תגובות: 1
    • צפיות: 151
    14-02-2014 13:07 עבור להודעה האחרונה
  15. שאלה| מזה ספין?

    קראתי בויקיפדיה ומוסבר שזוהי דרגת חופש של חלקיק. אבל מז"א דרגת חופש? מה המהירות שלו? כמה הוא יכול לנוע? והאם גרביטון נראה או הוכח שהוא קיים?< ומזה...

    • תגובות: 9
    • צפיות: 235
    14-02-2014 13:06 עבור להודעה האחרונה
  16. שאלה| איך עשו את זה?

    ראיתי תכתבה הזאת: http://www.mako.co.il/nexter-computers/software-photoshop/Article-92e7b0ad4910441006.htm?partner=obnetwork והעיניין הוא שיש שם...

    • תגובות: 4
    • צפיות: 169
    14-02-2014 00:11 עבור להודעה האחרונה
  17. שאלה| תדירות תנודות

    כשנתונה משוואת אנרגיה, ומבקשים את תדירות התנודות, אז אפשר לגזור, להשוות ל-0 ולהגיע למשוואת אוסילטור, שמשם ניתן למצוא את התדירות. אבל מה אם לאחר...

    • תגובות: 5
    • צפיות: 193
    14-02-2014 00:00 עבור להודעה האחרונה
  18. שאלה| זה נכון?

    בתור התחלה: עם יש כוכב ברחוק ממנו 50 שנות אור אז יקח לו 50 שנה לאור להגיע.. אז בעצם עם יהיה לי סופר טלסקופ ואני יהיה בכוכב שרחוק 50 שנות אור מכדור...

    2 עמודים
    1 2
    • תגובות: 23
    • צפיות: 427
    13-02-2014 22:03 עבור להודעה האחרונה
  19. שאלה| יש דרך לחמם את הגוף?

    אז יוצא לי לרוב לשים לב שאני קר יותר וגם מרגיש קר יותר מרוב האנשים. הידיים שלי נורא קרות כמעט כול הזמן ואני בעצמי מרגיש קר, עד כדי כך שאפילו כשאני...

    • תגובות: 7
    • צפיות: 224
    13-02-2014 14:48 עבור להודעה האחרונה
  20. שאלה| מדוע חומצות מוליכות

    הי אני עושה עבודה בכימיה ואני צריך להסביר מדוע חומצות שונות מוליכת זרם חשמלי אשמח לעזרה

    • תגובות: 8
    • צפיות: 190
    12-02-2014 23:03 עבור להודעה האחרונה
  21. עזרה בפיזיקה

    אני לא מבין מה זה בעצם מקסימום ומינימום בגלים,אם מישהו יוכל להסביר לי פה בקצרה.. תודה מראש

    • תגובות: 1
    • צפיות: 81
    12-02-2014 22:45 עבור להודעה האחרונה
  22. דיון| חוץ מכפות היידים וכפות הרגליים יש עוד..

    יהיה לי טעויות פה אז תתקנו אם אתם רוצים. נכון בשביל לזהות פושע יש צורך בDNA שלו ? כלומר אם הוא נגע באיזה אזור בזירת הפשע עם היד ? ככה מזהים נכון ?...

    2 עמודים
    1 2
    • תגובות: 20
    • צפיות: 298
    12-02-2014 17:55 עבור להודעה האחרונה
  23. שאלה| משיכה של בנות - האם בנות לא באמת אוהבות את הילדים היפים?

    קראתי מאמרים מאתרים מדעיים (שלפי מה שהבנתי מוכרים ומקובלים בעולם המדע) בנוגע למשיכה של בנות. הופתעתי מאוד כי זה סוג של סותר את כל מה שחשבתי על העולם...

    • תגובות: 5
    • צפיות: 667
    12-02-2014 17:53 עבור להודעה האחרונה
  24. עזרה| תדירות וזמן מחזור

    אהלן יש לי שאלה בנוגע לקשר בין תדירות וזמן מחזור. מהו בעצם זמן מחזור? האם הוא נמדד בשניות? הקשר בין תדירות לזמן מחזור הוא f=1/T. למה זה דווקא 1...

    • תגובות: 4
    • צפיות: 1,110
    12-02-2014 16:23 עבור להודעה האחרונה
  25. שאלה| אגדת שלושה וארבעה

    1)שלמה החכם מכל אדם מגלה מה הגורל הצפוי לבתו ומנסה למנוע אותו. באילו דרכים?מה הם נימוקיו? 2)מה מאפיין הנער העני מעכו? אילו מתכונותיו היו,לדעתכם...

    • תגובות: 3
    • צפיות: 368
    11-02-2014 23:21 עבור להודעה האחרונה

אחראי פורומים
מקרא דרגות:  » יו"ר » מנכ"ל » מנהל ראשי » מפקח » מנהל פורום » צוותי האתר » משתמש כבוד » היכל התהילה » Champ » משקיען כבוד » Winner