• הודעות
  • אשכולות
  • רשומים
  • לייקים
  • מחוברים כרגע

עמוד 182 ראשוןראשון 132172178179180181182183184185186192232 אחרוןאחרון

מדע וידע כללי

אשכול / מפרסם האשכול סטטיסטיקה הודעה אחרונה
  1. שאלה| ברזל

    אני צריך לדעת איך מוצאים ברזל, באיזה הרים, אם יש סוגים מיוחדים של אבנים אז איך קוראים להם ובאיזה מדינות יש יותר ברזל תודה :)

    • 2
    • 110
    20-02-2014 19:33 עבור להודעה האחרונה
  2. עזרה| סיכום כימיה לכיתה י

    למישהו יש סיכום של כל החומר לכימיה לכיתה י?

    • 3
    • 153
    20-02-2014 10:41 עבור להודעה האחרונה
  3. שאלה| למישהו יש תשובות של מיצב במדעים

    זה כמה מיצבים יש לנו חוברת מיצבים שאנחנו צריכים לעשות בבית ספר תשס"ו נוסח א' תשס"ז נוסח א' תשס"ח נוסח א' תשס"ט נוסח א'

    • 8
    • 676
    20-02-2014 10:39 עבור להודעה האחרונה
  4. שאלה| זה נכון שתא זרע זה התא היחיד .......

    זה נכון שתא זרע זה התא היחיד שיש בו רק חצי מהמטען הגנטי ? זאת אומרת רק 23 נוקלאוטוידים ?

    • 6
    • 121
    20-02-2014 09:59 עבור להודעה האחרונה
  5. שאלה| לאשה יש גם חומק שהיא מפרישה באורגזמה כמו הגברים?

    שהגברים באורגזמה הם מפרישים זרע האשה גם מפרישה איזה חומר ?

    • 13
    • 162
    20-02-2014 00:29 עבור להודעה האחרונה
  6. דיון| חושבים שיש קשר בין מקרה שקרה לאדם לאינטליגנציה שלו?

    אני מכיר אלפי סיפורים על ילדים שנודו מהחברה, שעברו טראומה, שאיבדו מישהו ועו' ומאז "נהיו חכמים יותר" שכן אם אותו מקרה לא היה קורה, כל "הכחמה"...

    • 3
    • 185
    19-02-2014 22:00 עבור להודעה האחרונה
  7. שאלה| סיפריה גנטית

    יש איזה אתר שבוא אני יכול למצא קוד גנטי של גנים מסוימים אני מדבר על רצף של נוקלאוטידים כמו ATGCCATGTATACGGATCTAA כחול - פרומוטר אדום -...

    • 3
    • 112
    19-02-2014 19:18 עבור להודעה האחרונה
  8. דיון| אולימפיאדת הפיזיקה שלב א

    מי ניגש? למדתם לזה? וכמה מינימום תשובות נכונות אתם חושבים שצריך בשביל לעלות לשלב ב?

    • 4
    • 439
    18-02-2014 20:57 עבור להודעה האחרונה
  9. שאלה| החוק השני של ניוטון

    קצת שאלה טיפשית אבל איך ניוטון יכל לדעת שהמשוואה שלו נכונה F=ma ? הרי שכדי למדוד את הכוח הוא השתמש במשוואה לא?

    NASAisr
    3 עמודים
    1 2 3
    • 34
    • 480
    17-02-2014 20:15 עבור להודעה האחרונה
  10. דיון| האם יש ליקום גבול כולשהו?

    באופן כללי גם אם אין כלום אחרי היקום חייב להיות לו איזשהו סוג של גבול יעני קצה כולשהו של היקום

    awe1234
    2 עמודים
    1 2
    • 20
    • 422
    17-02-2014 12:47 עבור להודעה האחרונה
  11. שאלה| ידוע היכן האסטרואיד פגע?

    אני מדבר על האסטרואיד שהכחיד את הדינוזאורים, ידוע איפה הוא פגע? ואם כן, המכתש שלו עדיין קיים?

    • 3
    • 247
    17-02-2014 01:36 עבור להודעה האחרונה
  12. שאלה| החוק השלישי של ניוטון

    ע''פ החוק השלישי של ניוטון,אם משאית מתנגשת ברוכב אופניים,רוכב האופניים לא אמור להפעיל על המשאית כוח השווה לכוח שהיא מפעילה עליו?אז למה רוכב האופניים...

    • 4
    • 218
    16-02-2014 16:42 עבור להודעה האחרונה
  13. כתבה| נמצאו העקבות העתיקות ביותר של "אדם קדמון" מחוץ לאפריקה.

    העקבות נמצאו בNORFOLK שבאנגליה, בנות מעל ל800 אלף שנה והושארו שם על ידי קבוצה של מבוגרים וילדים. בשל הגיוון בגדלים של העקבות, ככל הנראה מדובר במשפחה...

    • 12
    • 179
    16-02-2014 16:14 עבור להודעה האחרונה
  14. שאלה| מדוע השמיים כחולים?

    מדוע השמיים כחולים? ומדוע הקרחונים כחולים והשלג לבן? ישלי את השאלה הזאת ואני לא יודע מה לכתוב. תודה לעונים.

    • 10
    • 433
    15-02-2014 22:29 עבור להודעה האחרונה
  15. שאלה| מהי אנרגיית גובה..?

    אני למדתי השיעור במדעים על אנרגיית גובה ועדיין לא הבנתי מזה כל כך... אפשר הסבר? נ.ב קרינה זאת התפשטות אנרגיה נכון? כי המורה שלי אומרת שקרינה זה...

    BOBreches
    2 עמודים
    1 2
    • 22
    • 537
    15-02-2014 04:46 עבור להודעה האחרונה
  16. שאלה| פיסיקה-חשמל

    שלום. איך פותרים את סעיפים ב' וג' בשאלה?

    • 1
    • 154
    14-02-2014 14:07 עבור להודעה האחרונה
  17. שאלה| מזה ספין?

    קראתי בויקיפדיה ומוסבר שזוהי דרגת חופש של חלקיק. אבל מז"א דרגת חופש? מה המהירות שלו? כמה הוא יכול לנוע? והאם גרביטון נראה או הוכח שהוא קיים?< ומזה...

    • 9
    • 240
    14-02-2014 14:06 עבור להודעה האחרונה
  18. שאלה| איך עשו את זה?

    ראיתי תכתבה הזאת: http://www.mako.co.il/nexter-computers/software-photoshop/Article-92e7b0ad4910441006.htm?partner=obnetwork והעיניין הוא שיש שם...

    • 4
    • 169
    14-02-2014 01:11 עבור להודעה האחרונה
  19. שאלה| תדירות תנודות

    כשנתונה משוואת אנרגיה, ומבקשים את תדירות התנודות, אז אפשר לגזור, להשוות ל-0 ולהגיע למשוואת אוסילטור, שמשם ניתן למצוא את התדירות. אבל מה אם לאחר...

    • 5
    • 193
    14-02-2014 01:00 עבור להודעה האחרונה
  20. שאלה| זה נכון?

    בתור התחלה: עם יש כוכב ברחוק ממנו 50 שנות אור אז יקח לו 50 שנה לאור להגיע.. אז בעצם עם יהיה לי סופר טלסקופ ואני יהיה בכוכב שרחוק 50 שנות אור מכדור...

    FlyingMode
    2 עמודים
    1 2
    • 23
    • 427
    13-02-2014 23:03 עבור להודעה האחרונה
  21. שאלה| יש דרך לחמם את הגוף?

    אז יוצא לי לרוב לשים לב שאני קר יותר וגם מרגיש קר יותר מרוב האנשים. הידיים שלי נורא קרות כמעט כול הזמן ואני בעצמי מרגיש קר, עד כדי כך שאפילו כשאני...

    • 7
    • 224
    13-02-2014 15:48 עבור להודעה האחרונה
  22. שאלה| מדוע חומצות מוליכות

    הי אני עושה עבודה בכימיה ואני צריך להסביר מדוע חומצות שונות מוליכת זרם חשמלי אשמח לעזרה

    • 8
    • 190
    13-02-2014 00:03 עבור להודעה האחרונה
  23. עזרה בפיזיקה

    אני לא מבין מה זה בעצם מקסימום ומינימום בגלים,אם מישהו יוכל להסביר לי פה בקצרה.. תודה מראש

    • 1
    • 82
    12-02-2014 23:45 עבור להודעה האחרונה
  24. דיון| חוץ מכפות היידים וכפות הרגליים יש עוד..

    יהיה לי טעויות פה אז תתקנו אם אתם רוצים. נכון בשביל לזהות פושע יש צורך בDNA שלו ? כלומר אם הוא נגע באיזה אזור בזירת הפשע עם היד ? ככה מזהים נכון ?...

    Hawaii
    2 עמודים
    1 2
    • 20
    • 298
    12-02-2014 18:55 עבור להודעה האחרונה

מדע וידע כללי
בפורום זה תוכלו למצוא תשובות לשאלות שתמיד עניינו אתכם, ולפרסם ידיעות מתחום המדעים.הפורום נועד לשאילת שאלות שקשורות לבית הספר, ש''ב, התכוננות למבחנים וכד' בתחום המדע.כאן תוכלו, בין היתר, לשאול שאלות בפיזיקה, ביולוגיה, כימיה ובמגמות המדעיות בבתי הספר.
מנהלי הפורום
וידאו
משחקים וטכנולוגיה
מקרא דרגות:  » יו"ר » מנכ"ל » מנהל ראשי » מפקח » מנהל בכיר » מנהל פורום » צוותי האתר » משתמש כבוד » היכל התהילה » Champ » משקיען כבוד » Winner